Page 1
Health Hazard Evaluation Report 2015-0111-3271
Evaluation of Potential Hazards during
Harvesting and Processing Cannabis at an
Outdoor Organic Farm
HHE Report No. 2015-0111-3271
April 2017
James Couch, PhD, CIH, CSP, REHS/RS
Kerton Victory, PhD, MSc
Brian Lowe, PhD
Nancy C. Burton, PhD
Brett J. Green, PhD
Ajay Nayak, PhD
Angela R. Lemons, MS
Donald Beezhold, PhD
U.S. Department of Health and Human Services
Centers for Disease Control and Prevention
National Institute for Occupational Safety and Health
Page 2
Health Hazard Evaluation Report 2015-0111-3271
Contents
Highlights ...............................................i
Abbreviations ..................................... iii
Introduction ......................................... 1
Methods ............................................... 4
Results and Discussion ........................ 6
Conclusions ........................................ 16
Recommendations............................. 17
Appendix A ........................................ 19
Appendix B ........................................ 21
Appendix C ........................................ 23
References ......................................... 25
Acknowledgements ........................... 31
The employer is required to post a copy of this report for 30 days at or near the
workplace(s) of affected employees. The employer must take steps to ensure
that the posted report is not altered, defaced, or covered by other material.
The cover photo is a close-up image of sorbent tubes, which are used by the HHE
Program to measure airborne exposures. This photo is an artistic representation that may
not be related to this Health Hazard Evaluation. Photo by NIOSH.
Page i
Health Hazard Evaluation Report 2015-0111-3271
We evaluated cannabis
harvesting and processing tasks
at an outdoor organic cannabis
farm. If hand trimming tasks are
performed for longer periods
than we observed, the repetitive
hand motions create a risk for
hand and wrist musculoskeletal
disorders. Tetrahydrocannabinol,
the psychoactive component
in cannabis, was detected on all
surface wipe samples. Botrytis
cinerea, a plant pathogen that can
cause allergic reactions in exposed
individuals, was the predominant
fungal species identied.
Highlights of this Evaluation
The Health Hazard Evaluation Program received a request from a union representative for
an outdoor organic cannabis farm. The representative was concerned about the potential
occupational and safety hazards associated with harvesting and processing cannabis.
What We Did
● We visited the farm in August and October 2015.
● We observed work practices and evaluated ergonomic aspects of harvesting and
processing tasks.
● We collected air samples for microbes and endotoxin (products released by some bacteria).
● We collected surface wipe samples for
tetrahydrocannabinol.
● We interviewed employees about their work,
health, and safety concerns.
● We observed demonstrations for machine
trimming and nitrogen sealing.
What We Found
● Employees were concerned about repetitive
hand motions when trimming cannabis.
● Some hand trimming activities required a lot of
hand motions, but not a lot of force.
● Botrytis cinerea was the main fungal species in
the air.
● Actinobacteria was the most frequently
identied bacterial phyla in the air.
● We found tetrahydrocannabinol in every
surface wipe sample.
● Endotoxin concentrations were all below the
occupational exposure limit.
What the Employer Can Do
● Change hook line hanging heights to correspond with typical stem length and employee
working technique.
● Provide frequent breaks for employees when they are trimming cannabis by hand.
● Develop a plan to rotate employees among jobs that use different muscle groups.
Page ii
Health Hazard Evaluation Report 2015-0111-3271
● Train employees on tool cleaning, lubrication, sharpening, and maintenance.
● Develop a cleaning schedule to remove tetrahydrocannabinol from work and tool surfaces.
What Employees Can Do
● Wear nonlatex gloves when handling cannabis, cannabis products, or equipment that
contacts cannabis.
● Wash your skin with soap and water after removing gloves.
● Clean work surfaces after processing cannabis material.
Page iii
Health Hazard Evaluation Report 2015-0111-3271
Abbreviations
µg Microgram
µg/100 cm
2
Micrograms per 100 square centimeters
µg/mL Micrograms per milliliter
µL Microliter
ACGIH® American Conference of Governmental Industrial Hygienists
CFR Code of Federal Regulations
cm
2
Square centimeters
DECOS Dutch Expert Committee on Occupational Safety
DNA Deoxyribonucleic acid
EU Endotoxin unit
EU/m
3
Endotoxin units per cubic meter
lbs Pounds
mL Milliliter
NA Not applicable
ND Not detected
NIOSH National Institute for Occupational Safety and Health
OEL Occupational exposure limit
OSHA Occupational Safety and Health Administration
PCR Polymerase chain reaction
PEL Permissible exposure limit
rDNA Ribosomal deoxyribonucleic acid
REL Recommended exposure limit
THC delta-9-tetrahydrocannabinol
TLV® Threshold limit value
Page iv
Health Hazard Evaluation Report 2015-0111-3271
This page left intentionally blank
Page 1
Health Hazard Evaluation Report 2015-0111-3271
Introduction
The Health Hazard Evaluation Program received a request from the United Food and Commercial
Workers International Union to evaluate potential hazards associated with harvesting and
processing cannabis, commonly known as marijuana, at an outdoor organic farm. We visited the
farm in August and October 2015. We evaluated ergonomic, chemical, and microbial hazards and
conducted medical interviews with employees about their health concerns.
Background
The farm was located in the state of Washington, which has legalized cannabis for medicinal and
recreational use. At the time of our evaluation, the farm was operated by the owner and three
employees. The 5-acre farm grew organic cannabis, vegetables, and fruits without pesticides. The
farm grew Cannabis sativa, Cannabis indica, and a Cannabis sativa/indica hybrid.
Chemical and Biological Exposures in Outdoor Farming
Environments
Outdoor farming environments have numerous potential occupational exposures of concern.
We focused our evaluation on three exposures: endotoxins, microbial biodiversity (fungi
and bacteria), and delta-9-tetrahydrocannabinol (THC). Endotoxins are lipopolysaccharide
compounds that may be released by the outer cell walls of Gram-negative bacteria and can
cause adverse respiratory effects such as chronic bronchitis and asthma [Castellan 1995; Park
2006]. Fungi can produce health effects by four mechanisms: infections (e.g., pulmonary
aspergillosis), irritant reactions (e.g., burning, blistering skin), allergic reactions (e.g., allergic
rhinitis), and toxic reactions (e.g., gastrointestinal symptoms from ingesting mycotoxins)
[Trout et al. 2004]. THC is the psychoactive component in cannabis.
Process Description
According to the farm owner, seeding and cultivation began in February with each cannabis
plant grown from seed. Seedlings were cultivated in the greenhouse before they were
transplanted to the ground inside hoop houses. Hoop houses are large, semicircular structures
that are often made of fabric, which allows sunlight and air to reach plants. The number
of plants in each hoop house depended on plant type and size. After transplantation to the
hoop house, a screen of green netting was constructed, and the cannabis plant grew through
the screen. The screen allowed the cannabis plant to grow an even canopy, maximizing air
movement and light to each stem.
During our visit, the farm had approximately 40 plants that each grew to over 8 feet tall
and over 6 feet wide. At harvesting, an employee used hand pruners to rst remove large
outer stems and then continue removing more stems working inward toward the main
cannabis plant trunk. The large stem, also known as a cola, was cut in such a way as to form
a natural hook at the end furthest from the ower. The stems were transported by hand to
the big leang area. During our visit, the big leang area was in the same hoop house as the
harvested cannabis plants.
Page 2
Health Hazard Evaluation Report 2015-0111-3271
In the big leang area, a cotton line (also known as the hook line) was hung approximately
6–7 feet high from two posts approximately 10 feet apart, and drooped in the middle as
stems were added. The cola was hung directly on the hook line via the natural hook cut into
the plant during harvesting. The length of these colas was typically 12–18 inches, but one
measured 42 inches. At the hook line, outer leaves (which contain little THC) were removed
by pulling the leaves off or by cutting with hand pruners. The process of removing these large
leaves is known as big leang. Employees performed big leang while the cola hung from
the cotton line or by removing the cola and holding it with one hand while big leang with
the other. The trimmed colas were taken to the drying area and the big leaf trimmings were
collected in a large container. Employees were required to wear powder-free latex gloves
during big leang activities.
The drying area was a separate building that contained wire fencing material stretched
between building support columns. Using the natural hook, colas were placed on the wire
fencing and allowed to dry. Dehumidiers and fans were used to speed the drying process.
Professional judgment and moisture meters were used to determine if the product was dry
enough for destemming.
Destemming is the process of removing the ower from the cola’s stem. Employees used two
destemming methods. Some employees used bonsai tree trimming scissors to cut individual
owers one at a time. Other employees used a mint tin can with a half-inch hole drilled
through the metal (Figure 1). The stem was inserted through the hole, and the owers were
removed by pulling the cola through the tin’s drilled hole. As the cola was pulled through the
can, the owers fell into a container lined with a plastic bag. Flowers were collected from
both methods and moved to hand trimming. Employees were required to wear powder-free
latex gloves during destemming activities.
Hand trimming is the nal ower trimming step. It requires small, ne cuts to remove
unwanted plant material and make the ower presentable. Employees used two hand
trimming methods. Employees choose a hand trimming method based upon personal
preference and would switch between the two throughout the day. Employees performed the
rst hand trimming method while seated at a foldable banquet table covered with a plastic
tablecloth. They used a Trim Station™ to perform the second. The Trim Station was a plastic
device with dedicated bins to hold the unnished and trimmed product and tools. Curved
cutouts underneath helped hold the device on the user’s lap (Figure 2). The Trim Station also
contained a black foam ball for cleaning the trimming tool, a jar of trimming tool lubricant,
and a plastic bag attached below the trimming area to collect trimmings. Employees used a
variety of trimming tools including scissors, bonsai tree pruning scissors without a spring
return, and hand pruners with a spring return. The bonsai tree pruning scissors without a
spring return appeared to be the preferred tool for this work.
Page 3
Health Hazard Evaluation Report 2015-0111-3271
Figure 1. An employee removes the ower from the stem by pulling the stem through a small, drilled
hole in a tin can. Photo by NIOSH.
Figure 2. An employee using a Trim Station for the nal stage of ower hand trimming. The employee
is wearing a CyberGlove on the right hand and a latex glove on the left hand. Photo by NIOSH.
The farm was investigating the use of machine trimmers to automate the trimming process
and nal packaging with nitrogen sealing to preserve freshness. We observed demonstrations
of machine trimming and nitrogen sealing but neither were operational at a production scale
during our visit.
Page 4
Health Hazard Evaluation Report 2015-0111-3271
Methods
Our objectives were to:
1. Identify potential health hazards to employees related to harvesting and
processing cannabis.
2. Determine whether employees were experiencing work-related health symptoms or
had health concerns.
Our evaluation included the following: (1) ergonomic evaluation of work tasks, (2) air sampling
for endotoxins, (3) assessment of airborne microbiological diversity (fungi and bacteria), (4)
surface wipe sampling for THC, and (5) condential medical interviews with employees.
Ergonomic Evaluation
We observed harvesting tasks and recorded them by photograph and video. Employees
conrmed that the harvest activities we observed were typical for the farm.
During big leang tasks, we asked each of the four employees to simulate the pinch force
used to pull leaves off the stem. The pinch force was estimated by having the employee
duplicate that amount of force on a digital pinch force gauge (baseline, 100-pound [lb]
capacity). Each employee performed three trials and these measurements were averaged.
During the destemming process, employees used either bonsai tree trimming scissors or the
tin can method. To assess the force required to remove a bud with the bonsai tree trimming
scissors, we asked the three employees performing the destemming process to reproduce that
force by closing the scissors onto a digital force gauge (Figure 3). The force measurement
represents a simulation of the force required based on the employee’s estimate of the exerted
force. Each employee performed three trials and these measurements were averaged.
Figure 3. Bud snipping force was estimated by having the employee reproduce the force with the
handles of the scissors transmitting the force to the pinch gauge. Photo by NIOSH.
Page 5
Health Hazard Evaluation Report 2015-0111-3271
For the tin can method, we taped the end of the stem to a digital force gauge after the end
was inserted through the tin can’s orice. This was done to measure the minimum force
required to strip buds from the typical length stem when pulling the stem through the tin
can. A single employee assisted by holding the tin can while an investigator pulled the stem
through the device, using the minimum pull force necessary to strip the buds. We collected
10 measurements to estimate the bud stripping minimum pull force.
For nal hand trimming, we evaluated repetitive motion of the hand and ngers with a
CyberGlove System, a virtual reality electrogoniometer glove. This form-tting glove has
embedded sensors that span the nger and thumb joints. The device interfaced with a laptop-
based data acquisition system with custom-developed software (LabView v 10). All four farm
employees wore the electrogoniometer glove during hand trimming; the time ranged from 9
minutes to 35 minutes. For the employee with the most years of trimming experience (most
experienced), we recorded a single 9-minute segment of trimming work time. The three other
employees had data recording times of 35, 27, and 25 minutes. For these three employees,
54 intervals of 10 seconds each (equal to 9 minutes work time) were randomly selected from
the total data recording time to compare to the 9-minute work time for the most experienced
trimmer. We counted the motions of the thumb and ngers (closures of the scissors) for 540
seconds of work time for each participant. This was done manually from the time series
plotting the hand/nger joint position. Each closure of the scissors has a distinct signature
most observable in the index nger metacarpophalangeal joint (knuckle at the base of the
nger) and thumb opposition sensors. We created a time history plot from this data, and we
manually counted peaks corresponding to reversals in joint angle closure.
Air Sampling for Endotoxins
We collected breathing zone air samples on all four employees during their entire work shift
for 3 days. Each sample was collected using three-piece 37-millimeter closed-face cassettes,
preloaded with 0.45-micrometer-pore-size endotoxin-free polycarbonate lters. Samples
were collected at an air ow rate of 2 liters per minute. Samples were analyzed for endotoxin
content with the kinetic-chromogenic procedure using the limulus amebocyte lysate assay
[Cambrex 2005]. For these analyses, one endotoxin unit (EU) was equivalent to 0.053
nanograms of endotoxin. The limit of detection was 0.50 EU per sample. We also collected
11 area air samples for endotoxin, including two in the harvesting hoop house, three outside
the drying building, and six inside the drying building. We collected three task-based area air
samples for endotoxin during various machining activities.
Air Sampling for Microbes
We collected 26 full-shift, personal breathing zone and area air samples using a National
Institute for Occupational Safety and Health (NIOSH) two-stage bioaerosol sampler. We
collected full-shift personal breathing zone air samples from four employees over 3 days
(12 samples in all). We collected 14 area samples: eight in the drying room, three in the
greenhouse, and three outdoors. Complete details of the sampling and microbiological
diversity analysis are in Appendix B. In brief, we processed the deoxyribonucleic acid (DNA)
in the samples and used it to identify varieties of fungi and bacteria by comparing our results
Page 6
Health Hazard Evaluation Report 2015-0111-3271
to the National Center for Biotechnology Information database. The results are reported in
terms of relative abundance, which is the percentage of each type out of the total in the sample.
Surface Sampling for Tetrahydrocannabinol
We collected 33 surface wipe samples in areas with cannabis processing, before any
housekeeping. We also sampled the hand trimming scissor blades after hand trimming
but before cleaning, and after cleaning. For each sample we noted the location and recent
activities in the area. Where possible, we used a 100-square-centimeter (cm
2
) template to
sample a consistent surface area. The hand trimming scissor wipe sample area included both
blade surfaces (less than 100 cm
2
). Surface wipe samples were analyzed for THC using a
contract laboratory’s internal method. The method used liquid chromatography and tandem
mass spectrometry with a limit of detection of 40 ng per sample.
Employees cleaned scissors by either wiping them with an alcohol pad or placing them into a
jar of Scissor BUD-e™ cleaner and then wiping them by inserting and removing the scissors
multiple times into a black foam ball. While the act of taking a surface wipe sample from the
hand trimming scissor blade does remove THC, the “before cleaning” sample is an indication
of the THC amount on the hand trimming scissor blades after trimming. The sample collected
after the employee cleaned the scissors is an indication of the THC amount left after cleaning
and if THC is still present after normal cleaning procedures.
Medical Interviews
We interviewed all four employees about their health and safety concerns related to cannabis
processing. We discussed work history and exposure, use of personal protective equipment,
and symptoms when working with cannabis. Employees were also asked about long-term
health and safety concerns related to their job.
Results and Discussion
Ergonomic Evaluation
During harvesting activities, we observed an employee using hand cutters to remove the cola
from the erect cannabis plant. We observed multiple cuts on a single plant. The number of
cuts depends on the harvest size. Stems were typically cut at a vertical point below the waist
level of the farmer. In many cases, stem removal involved considerable horizontal reaching
(Figure 4A). The screen of green netting material creates a barrier restricting how close the
farmer can stand with respect to the horizontal distance from the feet to the cutting point.
Because of this restriction, the hands are farther from the lower spine (horizontally) when
bending to cut plant stems. This creates stooped postures with signicant trunk bend with
the weight of the trunk and arms creating pressure on the lower spine. This stooping posture
is considered a higher risk posture than that in which the feet were closer to the base of the
plant and the horizontal distance to the hands was reduced. It does not appear that substantial
vertical hand forces are associated with this task due to the light weight of the stems and the
cutter. However, any signicant pulling on the stem in the upward vertical direction from a
Page 7
Health Hazard Evaluation Report 2015-0111-3271
posture such as that in Figure 4B would worsen the biomechanical forces around the lower
spine. If the stem is cut cleanly, it does not appear that an upward pulling force is necessary.
Figure 4. Cola removal from the cannabis plant. The screen of green netting restricts how close the
harvester can position himself from the base of the plant. Photos by NIOSH.
We observed four employees performing the big leang process. The working posture in this
process was a function of multiple factors:
● Standing vs. sitting
● Height and arm length of employee
● Height of hanging line
● Length of stems, which determines the vertical range of hand positions
● Employee work technique
We observed two big leang techniques. The rst was performed with the cola hanging on
the line (Figure 5A). Leaving the cola on the hook line, some employees had to reach above
shoulder height. Figure 5B shows a work zone that was above the employee’s shoulder
height. The second big leang technique was performed when the employee lifted the stem
from the line and performed the big leang process while holding the stem with his hand at
mid-torso level. Because the weight of the cannabis stem is minimal, it likely contributes
little to shoulder muscle fatigue. Supporting the mass of the arms accounts for almost all of
the effort. Depending on the technique used, the optimal vertical height for the hook line will
vary. A combination of repetitive work above shoulder height could also increase the risk for
shoulder problems.
Page 8
Health Hazard Evaluation Report 2015-0111-3271
Figure 5. (A) Employee on left is shown big leang from a stem as it hangs on the line. Employee on the
right is big leang the stem by rst removing it from the line and holding by hand. (B) The red highlight
displays the work zone, which is greater than the employee’s shoulder height. Photos by NIOSH.
We asked each employee to use a digital pinch gauge to estimate the pinch force needed to
pull leaves off the stem. On the basis of three measurements per person, the estimated peak
level pinch forces in the removal of leaves for each employee were 8.3 ± 2.0, 3.4 ± 0.83, and
3.4 ± 0.32 pounds (lbs).
We asked each employee to use a digital pinch gauge to estimate the pinch force needed for
destemming. On the basis of three measurements per person for destemming with scissors,
the peak level cutting force estimates were 3.9 ± 1.1, 3.2 ± 0.61, and 1.9 ± 0.22 lbs. For
destemming with a tin can, the peak pull force averaged 6.2 ± 2.9 lbs over 10 measurements.
When using the tin can, it appeared that the pull force is a function of the length of the stem,
as longer stems tend to have more buds that are stripped using the pulling motion. Higher
pull forces increase the musculoskeletal stress during the task, which may lead to higher risk
of cumulative musculoskeletal disorders.
The tin can destemming method required more hand force than cola removal and big leang
because of the can’s lightweight construction and exion within the can. The tin can’s metal
is not designed for destemming activities or for prolonged use in this manner. An alternate
tool made of more durable, sturdy materials that could be attached to a table or work station
would create less hand stress and fatigue.
For nal hand trimming, the scissor closure motion count measured by the electrogoniometer
glove in the 540-second sampling period ranged from 336 to 1,030. Table 1 shows the
equivalent repetition rates in motions per second. The most experienced trimmer (more
than 10 years) exhibited a higher frequency of hand motions than the two least experienced
trimmers (less than 1 year) as displayed in Figure 6. The employee with intermediate
experience (more than 1 year but less than 10 years) fell between the highest and lowest
experienced employees but more closely resembled the lowest experienced employees. That
the number of cuts per unit time is greater (i.e., faster trimming) with the more experienced
employee(s) was an expected nding.
Page 9
Health Hazard Evaluation Report 2015-0111-3271
Table 1. Summary of repetitive hand motions in hand trimming*
Employee
experience
Total observation
time (minutes)
Sampling time
(minutes)
Average rate
(motions/second)
Peak rate
(motions/second)†
Most 9.0 9.0 1.91 3.2
Intermediate 35 9.0* 0.95 1.9
Low 25 9.0* 0.62 1.3
Low 27 9.0* 0.79 1.5
*To comprise these 9-minute sampling periods, 54 10-second intervals were selected randomly
from the total observation time.
†Calculated from highest count of motions observed in any 10-second interval. Thus, 32 motions
observed in a 10-second interval is a peak rate of 3.2 per second.
Figure 6. Line graph of hand motion example by level of hand trimming experience. The traces
represent thumb opposition joint motion (blue line) and index nger metacarpophalangeal joint motion
(orange line) while the y-axis represents reecting joint angle movement (raw sensor value).
Page 10
Health Hazard Evaluation Report 2015-0111-3271
We did not observe any employee performing hand trimming for a full workday. During our
visit, only small amounts of product were trimmed because it was late in the harvest season.
Employees noted that during the peak season, hand trimming was performed for an entire
work day. High frequency motion in hand trimming could increase the risk for hand, wrist,
and nger musculoskeletal disorders.
Employees noted that, during hand trimming, the trimmer becomes harder to open and close
as sticky residue builds up on it. Most often, employees reported cleaning trimmers only after
noticeable resistance was observed. The additional resistance increases the hand, wrist, and nger
forces needed for hand trimming and could increase the risk of musculoskeletal disorders.
Air Sampling for Endotoxin
Personal air sampling results for endotoxin are shown in Table 2. Endotoxin concentrations
ranged from 2.8 to 37 endotoxin units per cubic meter (EU/m
3
). Endotoxin concentrations
were highest for all four employees on day 1, when harvesting occurred. Employee 1
harvested the cannabis plant while employees 2, 3, and 4 performed big leang activities
nearby in the same hoop house. During big leang (Day 2), the maximum endotoxin
concentration measured was 24 EU/m
3
. Day 2 had the lowest endotoxin concentrations for all
four employees. No samples exceeded the Dutch Expert Committee on Occupational Safety
(DECOS) recommended limit of 90 EU/m
3
[DECOS 2010]. No occupational exposure limit
(OELs) for endotoxin have been established in the United States.
The airborne endotoxin concentrations at the cannabis farm were below those found in other
agricultural settings such as an indoor ower greenhouse with 38 employees (range: 0.84
to 1,100 EU/m
3
); two indoor herb processing plants with 70 and 90 employees (median
endotoxin concentration: 3×10
5
EU/m
3
); four peppermint and nine chamomile herb farm
indoor processing operations (median for endotoxin peppermint farms: 1×10
6
EU/m
3
; median
endotoxin for chamomile farms: 1.8×10
4
EU/m
3
); and an indoor hemp processing plant with
seven employees (mean endotoxin concentration: 1.9×10
4
EU/m
3
) [Dutkiewicz et al. 2001;
Fishwick et al. 2001; Skórska et al. 2005; Thilsing et al. 2015].
Endotoxin concentrations in area air samples, provided in Table A1, Appendix A, ranged
from not detected to 15 EU/m
3
. The highest area air sample endotoxin concentrations were
found in the hoop house on the rst day of sampling during harvesting and big leang
activities. Endotoxin was not detected in the three outdoor area air samples collected outside
the drying house. Endotoxin concentrations during task-based sampling for three machining
processes (Table A2, Appendix A) were 2.0 EU/m
3
for the large tumbling machine trimmer,
3.6 EU/m
3
for the horizontal machine trimmer, and 13 EU/m
3
for nitrogen sealing. The
nitrogen sealing demonstration took place in the hoop house where harvesting had been
performed 2 days earlier, while the two machine trimming demonstrations were performed in
the drying house.
Page 11
Health Hazard Evaluation Report 2015-0111-3271
Table 2. Personal breathing zone air sampling for endotoxins on October 27–29, 2015
Job/Activity Sample time
(minutes)
Total volume
(liters)
Concentration
(EU/m
3
)
Harvesting – October 27, 2015
Employee 1 466 950 37
Big leang/gross trimming – October 27, 2015
Employee 2 471 938 20
Employee 3 469 934 22
Employee 4 466 928 24
Big leang/gross trimming/destemming – October 28, 2015
Employee 1 415 818 6.1
Employee 2 414 798 2.9
Employee 3 418 812 3.8
Employee 4 409 795 2.8
Destemming/hand trimming – October 29, 2015
Employee 1 486 951 17
Employee 2 479 964 15
Employee 3 480 929 21
Employee 4 483 940 19
ACGIH® TLV® NA
NIOSH REL NA
OSHA PEL NA
DECOS 90
ACGIH = American Conference of Governmental Industrial Hygienists
NA = Not applicable
OSHA = Occupational Safety and Health Administration
PEL = Permissible exposure limit
REL = Recommended exposure limit
TLV = Threshold limit value
Air Sampling for Microbes
Bacterial Analysis
A total of 1,077 bacterial sequences were identied; these were clustered into 639 taxonomic
units. Figures 7A–7D show the relative abundance by phylum (7A), class (7B), most
common bacterial taxa (7C), and sampling location (7D). The relative abundance is the
percentage of each bacterial species compared to the total number of bacterial species. The
bacterial sequences were derived from the bacterial phyla listed in Figure 7A. The most
predominant phyla identied in the area and personal samples included Actinobacteria
(45%), Proteobacteria (26%), Firmicutes (15%), and Bacterioidetes (9%) (Figure 7A). An
additional 11 bacterial phyla were identied in the analysis and accounted for 4% of bacterial
sequences (Figure 7A).
Page 12
Health Hazard Evaluation Report 2015-0111-3271
Figure 7B depicts the relative abundance of individual bacterial classes for the four most
prominent bacterial phyla. Bacterial classes with over 10% relative abundance included
Actinobacteria (43%), Alphaproteobacteria (16%), and Bacilli (13%) (Figure 7B). Analysis
of the individual species is shown in Figure 7C. The most abundant species identied in
the area and personal samples accounted for 7% of bacterial sequences and consisted of
three genera: Arthrobacter spp. (2.5%), Nocardioides spp. (2.5%), and Bacillus spp. (2.1%)
(Figure 7C). In some eld and media negative controls, bacterial DNA derived from species
such as Bradyrhizobium elkanii were identied and subtracted from the personal and area air
sampling results to identify potential contaminant bacterial DNA and normalize all results.
Overall, no substantial differences in bacterial phyla relative abundance were observed
among the different sampling locations. Gram-positive bacteria belonging to the phylum
Actinobacteria, also known as Actinomycetes, comprised 47% in personal air samples,
51% in greenhouse samples, 46% in drying room samples, and 23% in outdoor area samples
(Figure 7D). Approximately, 40% of bacterial phyla were endotoxin-producing Gram-
negative bacteria. These gram-negative endotoxin-producing bacteria, as well as the Gram-
positive Actinomycetes, are known to cause adverse health effects, such as hypersensitivity
pneumonitis, chronic bronchitis, organic dust toxic syndrome, asthma, and allergic sensitization
[Lacey and Crook 1988; Mackiewicz et al. 2015; Park et al. 2006; Pepys et al. 1963].
Figure 7. Four bar charts that depict bacterial relative abundance by phylum (A), class (B), most
common bacterial taxa (C), and sampling location (D).
Page 13
Health Hazard Evaluation Report 2015-0111-3271
Fungal Analysis
Fungal DNA sequences derived from 985 sequences were clustered into 216 taxonomic
units. Figures 8A–8D are horizontal bar graphs showing the relative abundance by phylum
(8A), class (8B), most common fungal taxa (8C), and sampling location (8D). The relative
abundance is the percentage of each fungal species compared to the total number of fungal
species. The fungal sequences were placed into four fungal phyla and included the Ascomycota
(53%), Basidiomycota (46%), Zygomycota (1.2%), and Glomeromycota (0.5%) (Figure
8A). Figure 8B shows the relative abundance of classes derived from the two most prevalent
fungal phyla, the Ascomycota and Basidiomycota. The Agaricomycetes (Basidiomycota)
and the Leotiomycetes (Ascomycota) were the most abundant classes accounting for 42%
(Agaricomycetes) and 38% (Leotiomycetes) of fungal sequences. The Agaricomycetes
represent a class of fungi that decays wood and produces a wide diversity of fruiting structures
such as mushrooms. In contrast, the Leotiomycetes are a class placed in the Ascomycota
and includes a diverse group of fungi, many of which are plant pathogens that break down
agricultural products. In the present study, Botrytis cinerea, a plant pathogen of Cannabis sativa
that causes grey mold, was the most common fungal sequence in the analysis of personal and
area samples and accounted for 34% of fungal sequences (Figure 8C).
Figure 8D depicts the analysis of fungi in area and personal samples. Sequences placed in the
Basidiomycota were the predominant class identied in outdoor samples (91%) and within
the drying room (70%) (Figure 8C). Greenhouse samples included similar proportions of
Ascomycota (49%) and Basidiomycota (47%), as well as some Zygomycota (2.7%). Personal
air samples were dominated by sequences placed in the Ascomycota (87%, Figure 8D), and
the most prevalent species was the fungal plant pathogen Botrytis cinerea. This was the major
fungal species identied in the air samples, making up almost 60% of the fungi detected in
personal air samples, 19% of the drying room area air sample, 18% of the greenhouse area
air sample, and 6% in the outdoor sample. Botrytis cinerea is the most signicant fungal
pathogen of Cannabis and can affect the seedlings, stems, and buds [McPartland 1996;
Rodriguez et al. 2015]. Botrytis has been observed to be among the most frequently detected
fungal genera (10%–32% relative abundance) in European greenhouse environments
[Monsó et al. 2002; Radon et al. 2002]. Personal exposure to B. cinerea has been shown to
cause allergic sensitization in occupational settings such as green bell pepper greenhouses
[Groenewoud et al. 2002a], chrysanthemum greenhouses [Groenewoud et al. 2002b], and
table grape farms [Jeebhay et al. 2007].
Page 14
Health Hazard Evaluation Report 2015-0111-3271
Figure 8. Four bar charts that depict the fungal relative abundance by phylum (A), class (B), most
common fungal taxa (C), and sampling location (D).
Microbiological exposures including endotoxin, bacterial, and fungal species may place
workers at risk of allergic sensitization and respiratory issues. For example, B. cinerea has
previously been linked to a hypersensitivity pneumonitis condition commonly known as wine
grower’s lung [Popp et al. 1987].
Page 15
Health Hazard Evaluation Report 2015-0111-3271
Tetrahydrocannabinol
All 27 surface wipe samples were collected in cannabis production areas and had
detectable levels of THC. The surface wipe results ranged from 0.17 to 210 micrograms (µg)
per 100 cm
2
(µg/100 cm
2
). Table A3, Appendix A shows all 27 surface wipe sample levels. In
an evaluation of 30 indoor cannabis grow operations to investigate potential law enforcement
employee exposures, surface THC levels ranged from not detected to 2,000 µg/100 cm
2
with
a geometric mean of 0.37 µg/100 cm
2
[Martyny et al. 2013].
We collected six hand trimming scissor blade surface wipe samples. For three employees,
a sample was collected after hand trimming but before cleaning as well as after cleaning.
The THC levels before cleaning ranged from 61 to 180 µg per sample, while the levels after
cleaning ranged from 25 to 67 µg per sample. Table 3 shows the wipe sample result for each
employee both before and after cleaning. We cannot determine if the reduction in THC is due
to the cleaning procedure or the removal due to surface wipe sampling.
Table 3. Scissor surface wipe sampling for THC before and
after cleaning on October 28, 2015*
Sample Micrograms per sample
Employee 1
Before cleaning 180
After cleaning 67
Employee 2
Before cleaning 61
After cleaning 41
Employee 3
Before cleaning 110
After cleaning 25
*Scissors were sampled after hand trimming but before
cleaning and sampled again immediately after cleaning.
Raw cannabis plant material consists of various cannabinoid acids: (1)
tetrahydrocannabinolic acid, (2) cannabidiolic acid, and (3) cannabichromenic acid [Burstein
2014]. THC is the psychoactive component of cannabis, and previous cannabis exposure
assessments have typically involved sampling for THC [Martyny et al. 2013]. However, raw
cannabis plant material contains a number of precursor acids that must be decarboxylated in
order to form the psychoactive and medicinal components. Decarboxylation most commonly
occurs through heat application but may also result from aging. Because of the lack of heat
applications, surface wipe sample results may under report the range of THC compounds
present including the THC precursor acid (tetrahydrocannabinolic acid).
THC surface wipe sample results should be considered semiquantitative. Samples with high
concentrations required multiple dilutions while samples with lower concentrations did not
require as many or any additional dilutions to quantify the THC concentrations. The contract
Page 16
Health Hazard Evaluation Report 2015-0111-3271
laboratory noted that the recovery was dependent on the THC concentration and that the
reported values were likely an underestimate of the actual concentrations. Therefore, the
THC concentrations should be considered as semiquantitative and used to designate areas of
higher THC contamination. Currently, there are no OELs for THC.
We did not collect air samples for THC. A previous study of 30 indoor grow operations
indicated that measurable airborne THC levels were unlikely [Martyny et al. 2013]. The
study reported only one detectable air sample (0.70 µg per sample) while the rest did not
detect THC (limit of detection 0.10 µg per sample).
Medical Interviews
We interviewed all four employees at the farm including the owner/operator. They reported prior
work with cannabis with a range of less than 1 year to 17 years. Employees stated that harvesting
season (summer–fall) is the busiest time at the farm. All interviewed employees reported
performing several tasks at the farm including cultivating, cutting, and trimming of cannabis.
All interviewed employees stated that they always used powder-free latex or work gloves
when handling cannabis. However, we did observe employees not wearing gloves while
handling cannabis. The use of powdered latex gloves may lead to adverse health effects
ranging from allergic dermatitis to anaphylaxis and occupational asthma [Meade et al. 2002;
Sussman et al. 2002].
Employees were also asked whether they experienced symptoms that might be related to
working with cannabis. None reported any symptoms or health effects, such as rashes on the
skin or allergic reactions, which have been previously shown to be associated with cannabis
exposure [Decuyper et al. 2015]. No employee reported hand, wrist, or shoulder symptoms or
other musculoskeletal problems. However, employees did express concerns about whether they
might develop long-term musculoskeletal problems as a result of the way they trim the cannabis.
Employees also raised concerns about slips, trips, and falls. They also mentioned concerns about
the safety of the proposed use of automated trimmers during operation and cleaning.
Research on occupational health issues in the cannabis industry is limited. A study of 30
indoor grow facilities in Colorado evaluated potential exposures to rst responders [Martyny
et al. 2013]. That study identied potential dermal exposures to THC, fungal spores
(predominantly Cladosporium and Penicillium species), pesticides (primarily pyrethroids),
carbon monoxide, and carbon dioxide. The state of Colorado has issued occupational safety
and health guidance for the cannabis industry [CDPHE 2017].
Conclusions
We evaluated hazards associated with harvesting and processing cannabis at a small outdoor
organic farm. The four employees reported no health effects. Our ndings indicate that
the employees have exposures to highly repetitive and forceful work, most notably during
hand trimming activities. These exposures increase their risk of musculoskeletal disorders.
THC surface wipe concentrations indicate the potential for dermal and ingestion exposures.
However, the health implications from occupational exposure to THC is unknown. Airborne
Page 17
Health Hazard Evaluation Report 2015-0111-3271
exposure to Actinobacteria and fungus like B. cinerea can increase the risk of allergic and
respiratory symptoms. The employer should take measures to minimize these hazards.
Recommendations
On the basis of our ndings, we recommend the actions listed below. We encourage the farm
to discuss our recommendations and develop an action plan. Those involved in the work can
best set priorities and assess the feasibility of our recommendations for the specic situation
at the farm.
Our recommendations are based on an approach known as the hierarchy of controls. This
approach groups actions by their likely effectiveness in reducing or removing hazards. In
most cases, the preferred approach is to eliminate hazardous materials or processes and
install engineering controls to reduce exposure or shield employees. Until such controls
are in place, or if they are not effective or feasible, administrative measures and personal
protective equipment may be needed.
Engineering Controls
Engineering controls reduce employees’ exposures by removing the hazard from the process or by
placing a barrier between the hazard and the employee. Engineering controls protect employees
effectively without placing primary responsibility of implementation on the employee.
1. Improve the tin can bud removal method to eliminate tool exion during destemming.
Replace the tin can with a new tool made of more durable materials that can be
attached to a table or work station to lessen hand stress and fatigue.
2. Remove the screen of green netting during harvesting to allow the harvester to stand
closer to the cannabis plant. This change will reduce exposure to awkward postures.
3. Standardize procedures so that hook line hanging heights are in an optimal work zone
consistent with employee size and working technique. Determine a hook line hanging
height that is compatible with the typical stem length and working technique preferred
(sitting or standing) so that the upper arms are not in an elevated static posture. The
hook line height should keep the hands below shoulder height to the extent possible.
4. Consider hook line congurations that have standing and sitting options or alternate
sitting/standing.
5. Provide as much natural ventilation as possible by raising the sides of the hoop house
and opening doors when it is occupied.
Administrative Controls
The term administrative controls refers to employer-dictated work practices and policies
to reduce or prevent hazardous exposures. Their effectiveness depends on employer
commitment and employee acceptance. Regular monitoring and reinforcement are necessary
to ensure that policies and procedures are followed consistently.
1. Develop a job rotation plan to move employees working in high hand and nger
Page 18
Health Hazard Evaluation Report 2015-0111-3271
motion frequency tasks to other jobs that require using different muscle-tendon groups.
An effective job rotation plan will reduce the risk of musculoskeletal disorders.
2. Provide frequent breaks for employees working in high hand and nger motion
frequency tasks such as hand trimming.
3. Develop a cleaning schedule to remove THC from work and tool surfaces.
4. Provide training to employees on the cleaning, lubrication, sharpening, and
maintenance of tools according to manufacturer recommendations.
5. Encourage employees to report any work-related symptoms to their supervisor and to
their healthcare provider.
Personal Protective Equipment
Personal protective equipment is the least effective means for controlling hazardous
exposures. Proper use of personal protective equipment requires a comprehensive program
and a high level of employee involvement and commitment. The right personal protective
equipment must be chosen for each hazard. Personal protective equipment should not be
the sole method for controlling hazardous exposures. Rather, personal protective equipment
should be used until effective engineering and administrative controls are in place.
1. Wear nonlatex gloves when handling cannabis or equipment that may be contaminated
with THC. Many types of glove materials are available, such as nitrile, polyvinyl
chloride, neoprene, and polyvinyl alcohol. Each glove material provides different
levels of protection from chemicals, and varying levels of cut, tear, abrasion, puncture,
and thermal resistance.
2. Wash your skin with soap and water after removing gloves.
Page 19
Health Hazard Evaluation Report 2015-0111-3271
Appendix A: Tables
Table A1. Area air sampling for endotoxin on October 27–29, 2015
Job/Activity Sample time
(minutes)
Total volume
(liters)
Concentration
(EU/m
3
)*
Harvesting/big leang/gross trimming – October 27, 2015
Front of harvesting hoop house 435 860 13
Back of harvesting hoop house 434 868 15
Trimming area of drying house 450 895 ND
Next to drying plants in drying house 450 909 ND
Outside new drying house 421 836 ND
Big leang/gross trimming/destemming – October 28, 2015
Trimming area of drying house 423 830 ND
Next to drying plants in drying house 412 812 ND
Outside new drying house 409 795 ND
Destemming/hand trimming – October 29, 2015
Trimming area of drying house 522 1022 1.5
Next to drying plants in drying house 525 1016 1.7
Outside new drying house 504 978 ND
ACGIH TLV NA
NIOSH REL NA
OSHA PEL NA
DECOS 90
ND = Not detected
*The minimum detectable concentration of endotoxin ranged from 0.51 EU/m
3
to 0.63 EU/m
3
.
Table A2. Task-based area air sampling for endotoxin on October 28–29, 2015
Job/Activity Sample time
(minutes)
Total volume
(liters)
Concentration
(EU/m
3
)
Next to large tumbler 131 252 2.0
Next to machine trimming 198 388 3.6
Nitrogen sealing 46 89 13
ACGIH TLV NA
NIOSH REL NA
OSHA PEL NA
DECOS 90
Page 20
Health Hazard Evaluation Report 2015-0111-3271
Table A3. Surface wipe sampling for THC on
October 28, 2015
Location Level
(µg per 100 cm
2
)
Drying building
Table surface in front of dry trimmer 0.51
Table surface to right of dry trimmer 0.81
Dry trimmer exit chute 100
Preparation table 0.67
Preparation table near drying cannabis 2.5
Wood chest 3.9
Top of heater (not turned on) near
hand trimming
5.9
Table surface directly in front of dry
trimmer #2
120
Table surface to the right of dry
trimmer #2
6.9
Table surface to the left of dry
trimmer #2
5.5
Dry trimmer #2 chute 37
Dry trimmer #2 inside lid 1.8
Dry trimmer #2 outside lid 1.5
Hand trimming table 130
Hand trimming table #2 20
White chair seat at trimming table 140
Hoop house
Folding table 0.17
Trimming station after hand trimming 45
Trimming station after hand
trimming #2
1.0
Grey table near hand trimming station 210
Grey table near hand trimming
station #2
0.27
Folding chair at trimming station* 2.9
White chair near hood line* 5.2
Metal chair in sitting area* 2.7
Wood table in sitting area 1.4
Round table in sitting area 2.8
Chair near big leang 2.9
*The 100 cm
2
template could not be used so an estimated
100 cm
2
was sampled.
Page 21
Health Hazard Evaluation Report 2015-0111-3271
Appendix B: Methods
Air Sampling for Microbial Genomic Analysis
We collected aerosols at 2 liters per minute using a two-stage sampler with two cyclones
depositing into microcentrifuge tubes and onto a polytetrauoroethylene lter. The bioaerosol
samplers allowed for the collection of particles across three size fractions: > 4.1 micrometers,
1.0–4.1 micrometers, and < 1.0 micrometer aerodynamic diameter. The three size cut samples
taken with each bioaerosol sampler were aggregated for genomic DNA analysis.
Genomic DNA Extraction from Air Samples
We processed air samples separately for fungal and bacterial DNA extraction using the
Roche High Pure Polymerase Chain Reaction (PCR) Template kit as previously described
[Rittenour et al. 2012, 2014]. For air samples, including eld and media blank controls,
we combined each stage from the NIOSH BC251 air sampler prior to DNA extraction. We
sectioned the after lter into six pieces with a scalpel using aseptic methods. We placed these
pieces into a 2-milliliter (mL) bead-beater tube containing 300 milligrams of glass beads as
described above. We placed the tubes in liquid nitrogen for 30 seconds and processed in a
bead beater for 30 seconds. This process was repeated one more time. The High Pure PCR
Template kit lysis buffer (650 microliters [µL]) was then sequentially added to the rst and
second stage tubes and vortexed to collect the fungal and bacterial DNA from the samples.
The lysis buffer was added to the 2 mL bead-beater tube containing the macerated lter
material. We processed the tubes with a bead beater for 30 seconds and then centrifuged for
1 minute at 20,000 × g, a measure of relative centrifugal force. We collected the supernatant
and incubated with 40 µL Cell Lytic B lysis reagent (Sigma Aldrich) for 15 minutes at 37°C.
We mixed the sample with the kit’s binding buffer (200 µL) and proteinase K (40 µL) and
incubated at 70°C for 10 minutes. We washed the sample and eluted in 100 µL of isopropanol
as recommended by the manufacturer.
Fungal ITS and Bacterial 16S rDNA Amplication,
Cloning, and Sanger Sequencing
We targeted fungal ribosomal deoxyribonucleic acid (rDNA) for PCR amplication
as previously described [Rittenour et al. 2012, 2014]. Briey, fungal rDNA sequences
were amplied with the primer pair Fun18Sf (TTGCTCTTCAACGAGGAAT) and ITS4
(TCCTCCGCTTATTGATATGC). The fungal internal transcribed spacer-1 (ITS1) and ITS2
regions were amplied with Platinum Taq DNA polymerase (Invitrogen) according to the
methods previously described [Rittenour et al. 2012, 2014]. For fungal amplication, three
replicate PCR reactions (50 μL) were run for each sample by using 5 μL of DNA template.
These replicates were then combined, and the rDNA amplicons were puried with a Qiagen
PCR purication kit, according to the manufacturer’s instructions. We ran the puried
product (8 μL) on a 1% agarose gel containing 1 µg/mL ethidium bromide and examined for
amplicons with ultraviolet light.
Page 22
Health Hazard Evaluation Report 2015-0111-3271
We amplied bacterial 16S rDNA sequences with the use of the highly conserved primer
pair p8FPL (AGTTTGATCCTGGCTCAG) and p806R (GGACTACCAGGGTATCTAAT)
[McCabe et al. 1999]. We amplied the bacterial 16S rRNA genes with Invitrogen Platinum
Taq DNA polymerase by a modied method of [McCabe et al. 1999]. The PCR conditions
included initial denaturation at 95°C for 4 minutes, followed by 33 cycles of denaturation
at 94°C for 1 minute, annealing at 55°C for 1 minute, extension at 72°C for 2 minutes, and
completion with a nal extension at 72°C for 10 minutes. We ran three 50-μL replicate PCR
reactions for each sample with the use of 5 μL of DNA template. We combined the replicates,
and the rDNA amplicons were puried with a Qiagen PCR purication kit according to
the manufacturer’s instructions. We ran the puried product (8 μL) on a 1% agarose gel
containing 1 µg/mL ethidium bromide and examined for amplicons with ultraviolet light.
We separately cloned fungal and bacterial amplicons into the pDRIVE vector using a
Qiagen PCR cloning kit. We generated clone libraries by transforming cloned plasmids into
chemically competent Escherichia coli cells as previously described [Rittenour et al. 2012,
2014]. We selected positive colonies (as determined colorimetrically by the inactivation of
the lacZ gene) and cultured for 16 hours at 37°C in liquid Luria-Bertani media containing
100 µg/mL of ampicillin. Resultant cells were centrifuged at 1800 × g (relative centrifugal
force) and the pellet resuspended in 200 µL of 15% glycerol, and sent for Sanger sequencing
of the bacterial 16S insert from Genewiz, Inc. Inserts were sequenced in both directions,
allowing for sequence analysis of the 16S region.
Sequencing results were downloaded as “.ab1” chromatogram les from Genewiz Inc.
Vector sequence data were trimmed and forward and reverse sequences were assembled
using Biomatters Geneious R7 Software. Then we sequenced the DNA to identify which
varieties of bacteria were present in the air. Sequence data were then clustered into operational
taxonomic units with MOTHUR software version 1.32.1 using a 97% similarity cutoff as
described in previous publications [Rittenour et al. 2012, 2014; Schloss et al. 2009]. Sequences
representative of each operational taxonomic unit were then used in a Basic Local Alignment
Search Tool search against the National Center for Biotechnology Information database.
Page 23
Health Hazard Evaluation Report 2015-0111-3271
Appendix C: Occupational Exposure Limits and
Health Effects
Endotoxins
Endotoxins are found throughout the agricultural environment. Endotoxins are found in the
cell wall of Gram-negative bacteria and are released when the bacterial cell is lysed (broken
down) or when it is multiplying. In experimental studies, human volunteers exposed via
inhalation to high levels of endotoxin experience airway and alveolar inammation as well as
chest tightness, fever, and malaise, and have an acute reduction in lung function, as measured
by the forced expiratory volume in one second [Castellan 1995]. Airborne endotoxin
exposures between 45 and 400 EU/m
3
have been associated with acute airow obstruction,
mucous membrane irritation, chest tightness, cough, shortness of breath, fever, and wheezing
[Thorne and Duchaine 2007]. Chronic health effects that have been associated with airborne
endotoxin exposures include asthma, chronic bronchitis, bronchial hyper-reactivity,
chronic airway obstruction, hypersensitivity pneumonitis, and organic dust toxic syndrome
[Duquenne et al. 2013; Rylander 2006]. Some studies suggest that high environmental and
occupational endotoxin exposures may protect exposed individuals from developing atopic
sensitization [Rylander 2006].
Rylander and Jacobs have suggested an occupational threshold concentration for endotoxin
equivalent to 100 EU/m
3
of air to prevent airway inammation [Rylander and Jacobs 1997].
No accepted OELs have been developed in the United States because of the variability of
sampling and analytical methods, and because of a lack of data showing a consistent dose-
response relationship [AIHA 2005; Duquenne et al. 2013]. In 2010, DECOS recommended
a health-based OEL for airborne endotoxin of 90 EU/m
3
as an 8-hour time-weighted average
[DECOS 2010].
THC
THC is the psychoactive component of cannabis. The health effects from an effective dose
of cannabis may include mood changes, diminished memory, and disorientation [NIDA
2016]. Health effects from long-term occupational exposures are unknown, in part because
occupational exposures to THC are thought to be predominantly through skin absorption
and ingestion. Past THC and health effects research has focused primarily on inhalation in
nonoccupational settings.
The adverse health effects associated with nonmedicinal and chronic consumption of
THC derived from Cannabis sativa and Cannabis indica have been extensively studied
and reviewed [Hall and Degenhardt 2014; Volkow et al. 2014]. In contrast, the short-term
and long-term health effects of occupational exposure to Cannabis spp. material are not
well described in the literature. In addition to THC and cannabinol, cannabis production
employees may be exposed to a variety of plant-derived materials such as leaves, buds, sap/
exudate, owers, and pollen when handling the plant during cultivation and processing
procedures. They can also encounter other contaminant and plant pathogen sources such as
Page 24
Health Hazard Evaluation Report 2015-0111-3271
bacteria and fungi. These secondary exposures may result in occupational byssinosis, a lung
disease associated with textile bers (cotton, hemp, etc.) [Valic et al. 1968; Zuskin et al. 1990].
Hemp
Hemp, also derived from Cannabis sativa, is used for a variety of purposes including ber,
rope, paper composites, food, and oil and oil-based products [USDA 2000]. Occupational
hemp exposure can result in a variety of clinical symptoms including sinusitis, byssinosis,
and reductions in lung function [Zuskin et al. 1990, 1992, 1994]. Employees who directly
handle the plant are particularly at risk [Barbero and Flores 1967; Valic and Zuskin 1971;
Zuskin et al. 1990, 1994]. Transdermal applications of medicinal cannabis demonstrate
that occupational dermal absorption is a potential exposure route [Goldsmith 2015]. Other
studies have also demonstrated dermal reactions such as an urticarial rash (hives) in subjects
who directly contact cannabis [Basharat et al. 2011; Ozyurt et al. 2014]. Urticaria has also
occurred in forensic specialists and law enforcement ofcers following the handling of
cannabis [Herzinger et al. 2011; Majmudar et al. 2006; Mayoral et al. 2008; Williams et
al. 2008]. Several of these plant components have recently been shown to produce high
molecular weight proteins that can result in the allergic sensitization following personal
exposure [Nayak et al. 2013].
Page 25
Health Hazard Evaluation Report 2015-0111-3271
References
AIHA [2005]. Field guide for the determination of biological contaminants in environmental
samples. 2nd edition. Falls Church, Virginia: American Industrial Hygiene Association.
Barbero A, Flores R [1967]. Dust disease in hemp workers. Arch Environ Health 14(4):529–532.
Basharat P, Sussman G, Beezhold D, Leader N [2011]. Hypersensitivity reactions to
marijuana. J Allergy Clin Immunol 127(2):AB178,
http://dx.doi.org/10.1016/j.jaci.2010.12.707.
Burstein SH [2014]. The cannabinoid acids, analogs and endogenous counterparts. Bioorg
Med Chem 22(10):2830–2843, http://dx.doi.org/10.1016/j.bmc.2014.03.038.
Cambrex [2005]. Limulus Amebocyte Lysate (LAL), Kinetic-QCL. Catalog Number: 50-
650U. Walkersville, MD.
Castellan RM [1995]. Respiratory health effects of inhaled endotoxins: byssinosis and
beyond. In: McDufe H, Dosman J, Semchuk K, Olenchock S, eds. Agricultural health and
safety—workplace, environment, sustainability. Boca Raton, FL: CRC Press, pp. 97–100.
CDPHE [2017]. Guide to worker safety and health in the marijuana industry. Denver,
Colorado: Marijuana Occupational Health and Safety Work Group, Colorado Department of
Public Health and Environment (CDPHE),
https://www.colorado.gov/pacic/cdphe/marijuana-occupational-safety-and-health.
CFR. Code of Federal Regulations. Washington, DC: U.S. Government Printing Ofce,
Ofce of the Federal Register.
DECOS [2010]. Endotoxins: health-based recommended occupational exposure limit. The
Hague: Health Council of the Netherlands, Dutch Expert Committee on Occupational Safety,
http://www.gezondheidsraad.nl/sites/default/les/201004OSH.pdf.
Decuyper I, Ryckebosch H, Van Gasse AL, Sabato V, Faber M, Bridts CH, Ebo DG [2015].
Cannabis allergy: what do we know anno 2015. Arch Immunol Ther Exp 63(5):327–332,
http://dx.doi.org/10.1007/s00005-015-0352-z.
Dutkiewicz J, Krysińska-Traczyk E, Skórska C, Sitkowska J, Prazmo Z, Golec M [2001].
Exposure to airborne microorganisms and endotoxin in herb processing plants. Ann Agric
Environ Med 8(2):201–211.
Duquenne P, Marchand G, Duchaine C [2013]. Measurement of endotoxins in bioaerosols
at workplace: a critical review of literature and a standardization issue. Ann Occup Hyg
57(2):137–172, http://dx.doi.org/10.1093/annhyg/mes051.
Fishwick D, Allan LJ, Wright A, Curran AD [2001]. Assessment of exposure to organic dust
in a hemp processing plant. Ann Occup Hyg 45(7):577–583,
http://dx.doi.org/10.1093/annhyg/45.7.577.
Page 26
Health Hazard Evaluation Report 2015-0111-3271
Goldsmith RS, Targino MC, Fanciullo GJ, Martin DW, Hartenbaum NP, White JM, Franklin
P [2015]. Medical marijuana in the workplace: challenges and management options for
occupational physicians. J Occup Environ Med 57(5):518–525,
http://dx.doi.org/10.1097/JOM.0000000000000454.
Groenewoud GCM, de Graaf in ‘t Veld C, van Oorschot-van Nes AJ, de Jong NW, Vermeulen
AM, van Toorenenbergen AW, Burdorf A, de Groot H, Gerth van Wÿk R [2002a]. Prevalence
of sensitization to the predatory mite Amblyseius cucumeris as a new occupational allergen
in horticulture. Allergy 57(7):614–619.
Groenewoud GCM, de Jong NW, Burdorf A, de Groot H, Gerth van Wÿk RG [2002b].
Prevalence of occupational allergy to Chrysanthemum pollen in greenhouses in the
Netherlands. Allergy 57(9):835–840.
Hall W, Degenhardt L [2014]. The adverse health effects of chronic cannabis use. Drug Test
Anal 6(1-2):39–45, http://dx.doi.org/10.1002/dta.1506.
Herzinger T, Schopf P, Przybilla B, Rueff F [2011]. IgE-mediated hypersensitivity reactions
to cannabis in laboratory personnel. Int Arch Allergy Immunol 156(4):423–426,
http://dx.doi.org/10.1159/000324444.
Jeebhay MF, Baatjies R, Chang YS, Kim YK, Kim YY, Major V, Lopata AL [2007]. Risk
factors for allergy due to the two-spotted spider mite (Tetranychus urticae) among table grape
farm workers. Int Arch Allergy Immunol 144(2):143–149,
http://dx.doi.org/10.1159/000103226.
Lacey J, Crook B [1988]. Fungal and actinomycete spores as pollutants of the workplace and
occupational allergens. Ann Occup Hyg 32(4):515–533.
Mackiewicz B, Skorska C, Dutkiewicz J [2015]. Relationship between concentrations of
microbiological agents in the air of agricultural settings and occurrence of work-related
symptoms in exposed persons. Ann Agric Environ Med 22(3):473–477,
http://dx.doi.org/10.5604/12321966.1167717.
Majmudar V, Azam NA, Finch T [2006]. Contact urticaria to cannabis sativa. Contact
Dermatitis 54(2):127, http://dx.doi.org/10.1111/j.0105-1873.2006.0560h.x.
Martyny JW, Serrano KA, Schaeffer JW, Van Dyke MV [2013]. Potential exposures
associated with indoor marijuana growing operations. J Occup Environ Hyg 10(11):622–639,
http://dx.doi.org/10.1080/15459624.2013.831986.
Mayoral M, Calderon H, Cano R, Lombardero M [2008]. Allergic rhinoconjunctivitis caused
by cannabis sativa pollen. J Investig Allergol Clin Immunol 18(1):73–74.
McCabe KM, Zhang YH, Huang BL, Wagar EA, McCabe ERB [1999]. Bacterial species
identication after DNA amplication with a universal primer pair. Mol Genet Metab
66(3):205–211, http://dx.doi.org/10.1006/mgme.1998.2795.
Page 27
Health Hazard Evaluation Report 2015-0111-3271
McPartland JM [1996]. A review of Cannabis diseases. J Int Hemp Assoc 3(1):19–23.
Meade BJ, Weissman DN, Beezhold DH [2002]. Latex allergy: past and present. Int
Immunopharmacol 2(2-3):225–238.
Monsó E, Magarolas R, Badorrey I, Radon K, Nowak D, Morera J [2002]. Occupational
asthma in greenhouse ower and ornamental plant growers. Am J Respir Crit Care Med
165(7):954–960, http://dx.doi.org/10.1164/ajrccm.165.7.2106152.
Nayak AP, Green BJ, Sussman G, Berlin N, Lata H, Chandra S, ElSohly MA, Hettick JM,
Beezhold DH [2013]. Characterization of cannabis sativa allergens. Ann Allergy Asthma
Immunol 111:32–37e4, http://dx.doi.org/10.1016/j.anai.2013.04.018.
NIDA [2016]. DrugFacts: marijuana. Rockville, MD: U.S. Department of Health and Human
Services, National Institutes of Health, National Institute on Drug Abuse,
https://www.drugabuse.gov/publications/drugfacts/marijuana.
Ozyurt S, Muderrisoglu F, Ermete M, Afsar F [2014]. Cannabis-induced erythema
multiforme-like recurrent drug eruption. Int J Dermatol 53(1):e22–e23,
http://dx.doi.org/10.1111/j.1365-4632.2011.05318.x.
Park JH, Cox-Ganser J, Rao C, Kreiss K [2006]. Fungal and endotoxin measurements in
dust associated with respiratory symptoms in a water-damaged ofce building. Indoor air
16(3):192–203, http://dx.doi.org/10.1111/j.1600-0668.2005.00415.x.
Pepys J, Jenkins PA, Festenstein GN, Gregory PH, Lacey ME, Skinner FA [1963]. Farmer’s
lung: thermophilic actinomycetes as a source of “farmer’s lung hay” antigen. Lancet
2(7308):607–611.
Popp W, Ritschka L, Zwick H, Rauscher H [1987]. Berry sorter’s lung or wine grower’s
lung – an exogenous allergic alveolitis caused by Botrytis cinerea spores. Prax Klin Pneumol
41(5):165–169.
Radon K, Danuser B, Iversen M, Monso E, Weber C, Hartung J, Donham KJ, Palmgren U,
Nowak D [2002]. Air contaminants in different European farming environments. Ann Agric
Environ Med 9(1):41–48.
Rittenour WR, Park JH, Cox-Ganser JM, Beezhold DH, Green BJ [2012]. Comparison of
DNA extraction methodologies used for assessing fungal diversity via ITS sequencing. J
Environ Monit 14(3):766–774, http://dx.doi.org/10.1039/c2em10779a.
Rittenour WR, Ciaccio CE, Barnes CS, Kashon ML, Beezhold DH, Green BJ [2014]. Internal
transcribed spacer rRNA gene sequencing analysis of fungal diversity in Kansas City indoor
environments. Environ Sci Process Impacts 16(1):33–43,
http://dx.doi.org/10.1039/c3em00441d.
Rodriguez G, Kibler A, Campbell P, Punja ZK [2015]. Fungal diseases of Cannabis sativa
in British Columbia, Canada. Poster presented at The American Phytopathological Society
Annual Meeting; 2015 Aug 1–5; Pasadena, CA.
Page 28
Health Hazard Evaluation Report 2015-0111-3271
Rylander R, Jacobs RR [1997]. Endotoxin in the environment. Int J Occup Environ Health
3(1):S1–S31.
Rylander R [2006]. Endotoxin and occupational airway disease. Curr Opin Allergy Clin
Immunol 6(1):62–66, http://dx.doi.org/10.1097/01.all.0000202356.83509.f7.
Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB, Lesniewski RA,
Oakley BB, Parks DH, Robinson CJ, Sahl JW, Stres B, Thallinger GG, Van Horn DJ, Weber
CF [2009]. Introducing mothur: open-source, platform-independent, community-supported
software for describing and comparing microbial communities. Appl Environ Microbiol
75(23):7537–7541, http://dx.doi.org/10.1128/AEM.01541-09.
Skórska C, Sitkowska J, Krysińska-Traczyk E, Cholewa G, Dutkiewicz J [2005]. Exposure
to airborne microorganisms, dust and endotoxin during processing of peppermint and
chamomile herbs on farms. Ann Agric Environ Med 12(2):281–288.
Sussman GL, Beezhold DH, Liss G [2002]. Latex allergy: historical perspective. Methods
27(1):3–9, http://dx.doi.org/10.1016/S1046-2023(02)00045-2.
Thilsing T, Madsen AM, Basinas I, Schlünssen V, Tendal K, Bælum J [2015]. Dust,
endotoxin, fungi, and bacteria exposure as determined by work task, season, and type of plant
in a ower greenhouse. Ann Occup Hyg 59(2):142–157,
http://dx.doi.org/10.1093/annhyg/meu090.
Thorne PS, Duchaine C [2007]. Airborne bacteria and endotoxin. In: Hurst CJ, Crawford RL,
Garland JL, Lipson DA, Mills AL, Stetzenbach LD, eds. Manual of environmental microbiology.
3rd ed. Washington, DC: American Society for Microbiology Press, pp. 989–1004.
Trout DB, Seltzer JM, Page EH, Biagini RE, Schmechel D, Lewis DM, Boudreau AY [2004].
Clinical use of immunoassays in assessing exposure to fungi and potential health effects
related to fungal exposure. Ann Allergy Asthma Immunol 92(5):483–492,
http://dx.doi.org/10.1016/S1081-1206(10)61754-7.
USDA [2000]. Industrial hemp in the United States: status and market potential. United
States Drug Administration, Economic Research Service,
http://www.ers.usda.gov/media/328262/ages001e_1_.pdf.
Valic F, Zuskin E, Walford J, Kersic W, Paukovic R [1968]. Bysinnosis, chronic bronchitis and
ventilatory capacities in workers exposed to soft hemp dust. Br J Ind Med 25(3):176–186.
Valic F, Zuskin E [1971]. Effects of hemp dust exposure on nonsmoking female textile
workers. Arch Environ Health 23(5):359–364.
Volkow ND, Baler RD, Compton WM, Weiss SR [2014]. Adverse health effects of marijuana
use. N Engl J Med 370:2219–2227, http://dx.doi.org/10.1056/NEJMra1402309.
Page 29
Health Hazard Evaluation Report 2015-0111-3271
Williams C, Thompstone J, Wilkinson M [2008]. Work-related contact urticaria to cannabis
sativa. Contact Dermatitis 58(1):62–63, http://dx.doi.org/10.1111/j.1600-0536.2007.01169.x.
Zuskin E, Kanceljak B, Pokrajac D, Schachter EN, Witek Jr. TJ [1990]. Respiratory
symptoms and lung function in hemp workers. Br J Ind Med 47(9):627–632.
Zuskin E, Kanceljak B, Schachter EN, Witek Jr. TJ, Maayani S, Goswami S, Marom Z,
Rienzi N [1992]. Immunological ndings in hemp workers. Env Res 59(2):350–361.
Zuskin E, Mustajbegovic J, Schachter EN [1994]. Follow-up study of respiratory function in
hemp workers. Am J Ind Med 26(1):103–115.
Page 30
Health Hazard Evaluation Report 2015-0111-3271
Keywords: North American Industry Classication System 111910 (Tobacco Farming),
Washington, cannabis, marijuana, ergonomics, fungal, bacteria, hand, endotoxin, THC,
surface wipe, chemical, biological, physical, metagenomics
Page 31
Health Hazard Evaluation Report 2015-0111-3271
The Health Hazard Evaluation Program investigates possible health hazards in the workplace
under the authority of the Occupational Safety and Health Act of 1970 (29 U.S.C. § 669(a)
(6)). The Health Hazard Evaluation Program also provides, upon request, technical assistance
to federal, state, and local agencies to investigate occupational health hazards and to prevent
occupational disease or injury. Regulations guiding the Program can be found in Title 42, Code
of Federal Regulations, Part 85; Requests for Health Hazard Evaluations (42 CFR Part 85).
Disclaimer
The recommendations in this report are made on the basis of the ndings at the workplace
evaluated and may not be applicable to other workplaces.
Mention of any company or product in this report does not constitute endorsement by NIOSH.
Citations to Web sites external to NIOSH do not constitute NIOSH endorsement of the
sponsoring organizations or their programs or products. NIOSH is not responsible for the
content of these Web sites. All Web addresses referenced in this document were accessible as of
the publication date.
Acknowledgments
Analytical Support: Charles Neumeister, Jennifer Roberts, Bureau Veritas North America
Desktop Publisher: Shawna Watts
Editor: Ellen Galloway
Industrial Hygiene Field Assistance: Bradley King
Logistics: Donnie Booher, Kevin Moore
Availability of Report
Copies of this report have been sent to the employer and employees at the facility. The state and
local health department and the Occupational Safety and Health Administration Regional Ofce
have also received a copy. This report is not copyrighted and may be freely reproduced.
Recommended citation for this report:
NIOSH [2017]. Evaluation of potential hazards during harvesting and processing
cannabis at an outdoor organic farm. By Couch J, Victory K, Lowe B, Burton N, Green
B, Nayak A, Lemons A, Beezhold D. Cincinnati, OH: U.S. Department of Health and
Human Services, Centers for Disease Control and Prevention, National Institute for
Occupational Safety and Health, Health Hazard Evaluation Report Report 2015-0111-
3271, http://www.cdc.gov/niosh/hhe/reports/pdfs/2015-0111-3271.pdf.
To receive NIOSH documents or more information about
occupational safety and health topics, please contact NIOSH:
Telephone: 1–800–CDC–INFO (1–800–232–4636)
TTY: 1–888–232–6348
CDC INFO: www.cdc.gov/info
or visit the NIOSH Web site at www.cdc.gov/niosh
For a monthly update on news at NIOSH, subscribe to
NIOSH eNews by visiting www.cdc.gov/niosh/eNews.
Delivering on the Nation’s promise:
Safety and health at work for all people through research and prevention
